|
Getinge AB
self-expanding covered stent Self Expanding Covered Stent, supplied by Getinge AB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/self-expanding covered stent/product/Getinge AB Average 90 stars, based on 1 article reviews
self-expanding covered stent - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Innovagen AB
g2 peptide structure G2 Peptide Structure, supplied by Innovagen AB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g2 peptide structure/product/Innovagen AB Average 90 stars, based on 1 article reviews
g2 peptide structure - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
human mpp1 ![]() Human Mpp1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human mpp1/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
human mpp1 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
gli1 ![]() Gli1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gli1/product/Santa Cruz Biotechnology Average 95 stars, based on 1 article reviews
gli1 - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
slug ![]() Slug, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/slug/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
slug - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Proteintech
t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta ![]() T5 Caption A7 Gene Forward Reverse Atg3 5 Atgagcaacggcagccttta, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta/product/Proteintech Average 93 stars, based on 1 article reviews
t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
R&D Systems
sds page gel ![]() Sds Page Gel, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sds page gel/product/R&D Systems Average 93 stars, based on 1 article reviews
sds page gel - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
anti ext1 a 7 ![]() Anti Ext1 A 7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti ext1 a 7/product/Santa Cruz Biotechnology Average 94 stars, based on 1 article reviews
anti ext1 a 7 - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
brd4 antibody ![]() Brd4 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/brd4 antibody/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
brd4 antibody - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
chondroitin sulfate ![]() Chondroitin Sulfate, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chondroitin sulfate/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
chondroitin sulfate - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
mouse anti prak a 7 ![]() Mouse Anti Prak A 7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse anti prak a 7/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
mouse anti prak a 7 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
anti hyal4 antibody a 7 ![]() Anti Hyal4 Antibody A 7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti hyal4 antibody a 7/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
anti hyal4 antibody a 7 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 3. Generation of Tg-MPP1 mice. A, Upper panel: scheme of the plasmid used for the generation of Tg-MPP1 mice. Lower panel: PCR genotyping of ear- punch biopsies from 11 Tg-MPP1-positive mice with stable integration of the transgenic MPP1 cDNA into the genomic DNA. The negative control (-) did not contain genomic DNA, and the linearized MPP1 plasmid DNA (P) was used as a positive control. The lane marked with M, is the DNA marker. B, Immunoblot detection of the MPP1 protein in heart protein extracts from Tg-MPP1 mice and non-transgenic B6 mice. The left panel is a representative immunoblot, and the right panel shows quantitative data (mean ± s.d., n = 4 mice per group). The p- value is indicated and was determined by the unpaired, two-tailed, t-test. The lower panel is a control immunoblot detecting α-tubulin. C, As a specificity control of the monoclonal anti-MPP1 antibody, immunoblot detection of MPP1 in MPP1-transfected HEK cells was performed in comparison to mock- transfected HEK cells. The lower blot shows a loading control detecting GAPDH.
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Plasmid Preparation, Transgenic Assay, Negative Control, Positive Control, Marker, Western Blot, Two Tailed Test, Control, Transfection, Comparison
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 2. Upregulation of the MAGUK family protein, MPP1, in three different heart failure models. A,B, Probe set intensities of cardiac Mpp iso forms were determined by whole genome microarray gene expression profiling of the AAC-induced heart failure model in comparison to sham-operated con trols (A), and of Apoe−/− mice with long-term atherosclerosis-induced heart failure in comparison to age-matched non-transgenic B6 mice (B). Affymetrix IDs of probe sets detecting Mpp1, Mpp2, Mpp3, Mpp4, Mpp5, Mpp6, and Mpp7 are indicated. Data are mean values ± s.d. (four hearts per microarray chip with two microarray chips per group). Probe set intensities are taken from NCBI GEO dataset GSE25765. C, Cardiac transcript levels of Mpp isoforms in 8-month-old, male Tg-RKIP mice were determined by NGS in comparison to age- and sex- matched, non-transgenic FVB controls (NCBI GEO dataset GSE191316) (mean ± s.d., n = 3 mice per group). Statistically significant differences between transcript levels of the heart failure groups and the respective control group were determined by Tukey’s test, and are indicated for each individual MAGUK gene (A,B,C). P-values for statistically different MAGUK genes are indicated. All other MAGUK genes were not significantly different (n.s.) between the heart failure and control groups.
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Microarray, Gene Expression, Comparison, Transgenic Assay, Control
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 4. Tg-MPP1 mice develop features of heart failure with cardiac enlarge ment at an age of 8 months. A, Echo cardiographic measurement of the left ventricular ejection fraction (LVEF, %), the fractional shortening (FS, %), the left ventricular internal diameter in diastole (LVIDd), and the left ventricular internal diameter in systole (LVIDs) of 8-month- old, male Tg-MPP1 mice, and sex- and age-matched, non-transgenic B6 mice. Echocardiographic measurements were performed under anesthesia. B, Determi nation of the body weights (BW), heart weights (HW), and the heart weight to body weight ratios (HW/BW) of 8-month- old, male Tg-MPP1 mice, and of sex- and age-matched, non-transgenic B6 mice. Data (A,B) are the mean ± s.d., n = 6 mice per group. P-values were determined by the unpaired, two-tailed t-test. C, Immu nohistological detection of MPP1 on heart sections of Tg-MPP1 mice in comparison to those of non-transgenic B6 mice (n = 4 mice/group; bar: 2 mm). Sections were stained with the anti-MPP1 antibody (MPP1) and counterstained with hema toxylin (HE). The right panels show higher magnification images of representative sections from a Tg-MPP1 mouse and a non- transgenic B6 control (bar: 20 μm).
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Transgenic Assay, Two Tailed Test, Comparison, Staining, Control
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 5. Co-localization of AGTR1 with MPP1 in vivo, and increased cardiac AGTR1 protein levels in Tg- MPP1 mice. A, Immunofluorescence detection of MPP1 and AGTR1 on cardiac cryosections from Tg-CMV- AGTR1-Cerulean mice shows co-localization of AGTR1 with MPP1 on sarcolemmal membranes (yellow). MPP1 was stained with mouse monoclonal anti-MPP1 antibody (red), AGTR1-Cerulean was stained with rabbit poly clonal anti-GFP antibodies (green), and nuclei were stained with DAPI (blue). The immunofluorescence co- localization study shows cryosections from four different mice (bar: 40 μm). B, Cardiac AGTR1-specific binding sites were determined on sarcolemmal mem branes of Tg-MPP1 mice and non-transgenic B6 mice by radioligand binding with Sar1,[125I]Tyr4,Ile8-angiotensin II. Data are shown as mean values ± s.d., n = 6 mice per group. The p-value was determined by the unpaired, two- tailed t-test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: In Vivo, Immunofluorescence, Staining, Binding Assay, Transgenic Assay, Two Tailed Test
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 6. MPP1 increased the cellular contents of AGTR1eYFP in HEK cells. A,B, Cellular AGTR1eYFP levels were increased by co-transfection of HEK293 cells with an MPP1-encoding pcDNA3 expression plasmid (+). Control cells were transfected with the pcDNA3 plasmid without insert (-). Panel (A) shows cellular AGTR1eYFP fluorescence peak intensities at an emission wavelength of 527 nm, and panel (B) shows representative AGTR1eYFP fluorescence emis sion spectra without (grey) and with MPP1-encoding plasmid co-transfection (red). The black line shows a spectrum of control cells transfected with pcDNA3 without insert (Cont.). C,D, Co-transfection of the MPP1-encoding plasmid did not significantly alter cellular ADRB1eYFP levels. Control cells were trans fected with the pcDNA3 plasmid without insert (-). Panel (C) shows cellular ADRB1eYFP fluorescence peak intensities at an emission wavelength of 527 nm, and panel (D) shows representative fluorescence emission spectra of ADRB1eYFP-expressing cells without and with MPP1-encoding plasmid co- transfection. Data (A,C) show mean values ± s.d. (n = 8 biological replicates). P-values were determined by Tukey’s test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Cotransfection, Expressing, Plasmid Preparation, Control, Transfection, Fluorescence
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 7. AGTR1-(1–319)-eYFP with deletion of the carboxyl terminal tail is also enhanced by MPP1 in HEK cells. A, Cellular fluorescence peak intensities at an emission wavelength of 527 nm were deter mined of HEK cells with expression of the full-length AGTR1-(1–359)-eYFP without (-) and with (+) co- transfection of the MPP1-encoding plasmid, and of HEK cells with expression of the truncated AGTR1- (1–319)-eYFP without (-), and with (+) co- transfection of MPP1. Data are mean values ± s.d. (n = 10 biological replicates). P-values were deter mined by Tukey’s test. B, Topological scheme of the full-length AGTR1-(1–359) protein sequence. Trun cated residues of AGTR1-(1–319) are marked in red. The AGTR1 topology was derived from Uniprot (P30556 AGTR1_Human), and the scheme was drawn with Protter, version 1.0. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Fluorescence, Expressing, Cotransfection, Plasmid Preparation, Sequencing, Derivative Assay
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 9. The AGTR1-enhancing effect mediated by MPP1 requires all functional domains of MPP1. A, Scheme of MPP1 functional domains, and of the two MPP1 fragments 1–267 and 268–466, which were tested. B, Cellular fluorescence peak intensities at an emission wavelength of 527 nm were determined of AGTR1eYFP-expressing HEK cells without (-) and with (+) co- transfection of MPP1-encoding plasmid, MPP1-(1–267)-encoding plasmid, MPP1-(268–466)-encoding plasmid, or MPP1-(1–267) and MPP1-(268–466)- encoding plasmids together. Data are presented as mean values ± s.d. (n = 4 biological replicates). P-values were determined by Tukey’s test.
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Functional Assay, Fluorescence, Expressing, Cotransfection, Plasmid Preparation
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 8. Deletion of a putative internal PDZ domain-binding motif in AGTR1-(1–319)-(Δ213-220)-eYFP abolishes the AGTR1-enhancing effect by MPP1 in HEK cells. A, Topological scheme of the AGTR1-(1–359) protein sequence, in which deletions made in construct AGTR1-(1–319)-(Δ213-220) are marked in red. The scheme was drawn with Protter, version 1.0. Residues 213–220 at the beginning of the third intracellular loop of AGTR1 include the sequence “Y-T-L-I”, which could be an internal PDZ domain-binding motif, which is defined by “X-S/T-X-ϕ“ where “X” can be any amino acid, and “ϕ“ is a hydrophobic amino acid. B, Cellular fluorescence peak intensities at an emis sion wavelength of 527 nm were determined of HEK cells without (-) and with stable MPP1 (+) expression, and transfection of AGTR1-(1–319)-eYFP, or AGTR1-(1–319)-(Δ213-220)-eYFP with deletion of a putative internal PDZ domain-binding motif (Δ213-220). Data are presented as mean values ± s.d. (n = 3 biological replicates). P-values were determined by Tukey’s test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Binding Assay, Sequencing, Construct, Fluorescence, Expressing, Transfection
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 10. Upregulation of cardiac Mpp1 transcript levels by diabetes- induced cardiac dysfunction and by Hdac3 deficiency in rodents. A, Car diac Mpp1 transcript levels were up-regulated in rats with diabetes-induced cardiac dysfunction. Data were retrieved from the GEO profile GDS3153 (31), probe set ID 1389963_at of the Affymetrix Rat Expression 230A Array. Hearts were obtained from 12-week-old rats with four weeks of streptozotocin-induced diabetes and from control rats (mean ± s.d., n = 3 hearts per group). B, Upregulation of cardiac Mpp1 in hearts from 6-week-old mice with Hdac3- deficiency (Hdac3 KO) in heart and skeletal muscle (HDAC3fl/fl/MCK-Cre), which develop a severe hypertrophic cardiomyopathy on a high fat diet (32). Control hearts were isolated from wild-type mice (HDAC3fl/fl). Data were taken from the GEO profile GDS4886, probe set ID 106447481 of the Affymetrix Mouse Gene 1.0 ST Array (mean ± s.d., n = 4 male mice per group). P-values were determined by the unpaired, two-tailed t-test.
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Expressing, Control, Isolation, Two Tailed Test
Journal: Biochemical pharmacology
Article Title: Identification of membrane palmitoylated protein 1 (MPP1) as a heart-failure-promoting protein triggered by cardiovascular risk factors and aging.
doi: 10.1016/j.bcp.2023.115789
Figure Lengend Snippet: Fig. 11. Detection of increased MPP1 transcript levels in peripheral blood mononuclear cells of old human research participants. A-F, Transcript levels of MPP1 (A), GRK2 (B), GRK3 (C), DUSP3 (D), LRRN3 (E), and CD27 (F) in PBMC from old (age: 75–89 years, y; n = 5) human research participants were determined by whole genome microarray gene expression profiling. PBMC isolated from middle-aged research participants (age: 35–50 years, y; n = 4) served as the control group. Data are shown as mean values ± s.d. P-values were determined by the two- tailed (A,B,D,E,F), or one-tailed (C), unpaired t-test.
Article Snippet: Antibodies used for immunoblot detection, immunohistology and immunofluorescence The study used the following antibodies: rabbit monoclonal antiMPP1 antibody was raised against a synthetic peptide derived from the sequence of MPP1 ([EPR5865], ab108528; Abcam, Cambridge, UK); mouse monoclonal anti-MPP1 antibody was raised against an epitope within amino acids 320–376 of
Techniques: Microarray, Gene Expression, Isolation, Control, Two Tailed Test, One-tailed Test
Journal: Leukemia
Article Title: P4HA2 hydroxylates SUFU to regulate the paracrine Hedgehog signaling and promote B-cell lymphoma progression.
doi: 10.1038/s41375-024-02313-8
Figure Lengend Snippet: Fig. 1 P4HA2 interacts with KIF7 and regulates the Hedgehog signaling. A P4HA2 interacts with KIF7. HEK293T cells were transfected with Flag-tagged P4HA2. Cell lysates were prepared and subjected to immunoprecipitation (IP) with M2 anti-Flag beads. The immunoprecipitates were analyzed by Western blotting (WB) with anti-Flag and KIF7 antibodies. B KIF7 interacts with P4HA2. HEK293T cells were transfected with Flag-tagged KIF7. Cell lysates were prepared and subjected to Flag IP. The immunoprecipitants were analyzed by WB with anti-Flag and P4HA2 antibodies. C Schematic representation of the SHH signaling pathway. SAG is a chlorobenzothiophene-containing Hh pathway agonist and binds to the SMO heptahelical bundle in a manner that antagonizes cyclopamine action. SAG activates SMO, leading to the release of GLI1 by SUFU, and the Hh signaling pathway is then activated. D–I Knockout of P4HA2 causes suppression of Hedgehog signal transduction. NIH/3T3 (D–F) and OP9 (G–I) P4HA2 knockout (KO) or vehicle cells were treated with (+) or without (−) 200 nM SAG. The Hh targeted genes, Gli1 (E, H) and Ptch1 (F, I), were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Data are shown as the mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. All experiments were repeated three times independently.
Article Snippet: The following antibodies were used for western blotting (WB), immunofluorescence (IF): PAN-OH (home-made; 1:1,000 for WB); P4HA2 (13759-1- AP, rabbit, Proteintech; 1:1,000 for WB, 1:100 for IHC, 1:200 for IF); P4HA1 (12658-1-AP, rabbit, Proteintech; 1:1,000 for WB); KIF7 (24693-1-AP, rabbit, Proteintech; 1:1,000 for WB, 1:100 for IHC); SUFU (26759-1-AP, rabbit, Proteintech; 1:2,000 for WB); Flag (clone M2, F1804, mouse, Sigma-Aldrich; 1:10,000 for WB, 1:200 for IF); His (clone OGHis, D291-3, mouse, Medical & Biological Laboratories; 1:5,000 for WB); V5 (AB3792, rabbit, Merck Millipore; 1:2,000 for WB);
Techniques: Transfection, Immunoprecipitation, Western Blot, Knock-Out, Transduction, Real-time Polymerase Chain Reaction, Quantitative RT-PCR
Journal: Leukemia
Article Title: P4HA2 hydroxylates SUFU to regulate the paracrine Hedgehog signaling and promote B-cell lymphoma progression.
doi: 10.1038/s41375-024-02313-8
Figure Lengend Snippet: Fig. 3 P4HA2 migrates with KIF7 to regulate the Hedgehog pathway transduction. A The trafficking of the P4HA2-KIF7 complex from the cytoplasm to the cilium responds to Hedgehog signaling. NIH/3T3 cells were co-infected with KIF7-BFP and P4HA2-EGFP lentivirus. White arrow indicates the co-localization of cilia, KIF7-BFP and P4HA2-EGFP. Yellow arrow indicates the co-localization of cilia and P4HA2-EGFP, which may bind with endogenous KIF7. Cells were treated with 200 nM SAG (+) or not (−). Cells were fixed and stained with antibodies for ARL13B to mark primary cilia. Scale bars: 5 μm. B Statistical analysis of the relative colocalization rate in (A) indicated cells. Data are shown as the mean ± SEM; SAG (−), n = 11; SAG (+), n = 13. **P < 0.01. C The regulation of the Hedgehog signaling by P4ha2 is dependent on KIF7. KIF7 knockout (KO) and the control cells were knocked down with P4HA2 (shP4HA2). Cells were treated with (+) or without (−) 200 nM SAG. qRT- PCR analysis of GLI1 transcripts was performed using RNA isolated from the indicated cell lines. Data are shown as the mean ± SEM (n = 3). ***P < 0.001. All experiments were repeated three times independently.
Article Snippet: The following antibodies were used for western blotting (WB), immunofluorescence (IF): PAN-OH (home-made; 1:1,000 for WB); P4HA2 (13759-1- AP, rabbit, Proteintech; 1:1,000 for WB, 1:100 for IHC, 1:200 for IF); P4HA1 (12658-1-AP, rabbit, Proteintech; 1:1,000 for WB); KIF7 (24693-1-AP, rabbit, Proteintech; 1:1,000 for WB, 1:100 for IHC); SUFU (26759-1-AP, rabbit, Proteintech; 1:2,000 for WB); Flag (clone M2, F1804, mouse, Sigma-Aldrich; 1:10,000 for WB, 1:200 for IF); His (clone OGHis, D291-3, mouse, Medical & Biological Laboratories; 1:5,000 for WB); V5 (AB3792, rabbit, Merck Millipore; 1:2,000 for WB);
Techniques: Transduction, Infection, Staining, Knock-Out, Control, Quantitative RT-PCR, Isolation
Journal: Acta Cardiologica Sinica
Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice
doi: 10.6515/ACS.202005_36(3).20190906B
Figure Lengend Snippet: The primers in RT-PCR of this study
Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH;
Techniques:
Journal: Acta Cardiologica Sinica
Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice
doi: 10.6515/ACS.202005_36(3).20190906B
Figure Lengend Snippet: The autophagic genes based on the DNA methylation array
Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH;
Techniques: DNA Methylation Assay
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: EXT1 and EXT2 expression in different types of cancers and LUSC (Oncomine and UALCAN). (A) Red indicates up‐regulated expression and blue indicates down‐regulated expression in the tumor tissues. Higher significance is indicated by a darker shade. The number within cells represents the number of datasets. (B and C) The expression of EXT1 and EXT2 in the LUSC samples in two datasets (Talbot Lung and Hou Lung). (D and E) The expression levels of EXT1 and EXT2 were up‐regulated in LUSC tissues. (EXT: Exostosin, LUSC: lung squamous cell carcinoma)
Article Snippet: The
Techniques: Expressing
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: EXT1 and EXT2 expression in LUSC based on clinical data from the UALCAN. (A–H) EXT1 and EXT2 were significantly correlated with age of onset, pathological stage, lymphatic metastasis, moking habits, histological subtypes, and TP53‐muation status. (EXT, Exostosin; LUSC, lung squamous cell carcinoma)
Article Snippet: The
Techniques: Expressing
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: EXT1 and EXT2 expression in NSCLC cell lines. (A) The cell line indicated by the red arrow is Lung‐NSC. EXT1 and EXT2 were overexpressed in Lung‐NSC cell lines (CCLE). (B) EXT1 and EXT2 expression in human NSCLC cell lines. C, D: EXT1 and EXT2 protein expression in human NSCLC cell lines. (** p < 0.01, * p < 0.05 as compared with the HBE cell line). (EXT, Exostosin; LUSC, lung squamous cell carcinoma, NSCLC, Non‐small cell lung cancer; CCLE, Cancer Cell Line Encyclopedia)
Article Snippet: The
Techniques: Expressing
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: Kaplan–Meier plots for mRNA expression of EXT1 and EXT2 in LUSC patients (GEPIA). (A) EXT1 overexpression was significantly associated with poor prognosis of overall survival ( p < 0.027) but not with disease free survival. (B) EXT2 expression was not significantly associated with prognosis. (EXT, Exostosin; LUSC, lung squamous cell carcinoma; GEPIA, Gene Expression Profiling Interactive Analysis)
Article Snippet: The
Techniques: Expressing, Over Expression, Gene Expression
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: Genes co‐expressed with EXT1 . The top 100 co‐expressed genes in LUSC were screened from the Gemma Cell Line dataset in the Oncomine database (EXT, Exostosin; LUSC, lung squamous cell carcinoma)
Article Snippet: The
Techniques: Gas Phase Electrophoretic Molecular Mobility Analysis
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: PPI network of genes co‐expressed with EXT1 (A) PPI network of genes co‐expressed with EXT1 constructed in the STRING database. (B) Visualization of a STRING‐derived network of molecular interactions in Cytoscape pathway visualization and analysis software (EXT1, Exostosin; PPI, protein‐protein interaction; STRING, Search Tool for the Retrieval of Interacting Genes)
Article Snippet: The
Techniques: Construct, Derivative Assay, Software
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: GO functional annotation enrichment and KEGG pathway enrichment analysis of genes co‐expressed with EXT1 . (A) Co‐expressed genes were most enriched in cell adhesion and migration associated annotations (B) Co‐expressed genes were most enriched in cancer related pathways such as focal adhesion, ECM‐receptor interaction, proteoglycans in cancer, complement and coagulation cascade, tumor necrosis factor signaling pathway, cell death, etc. (EXT, Exostosin; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; LUSC, lung squamous cell carcinoma)
Article Snippet: The
Techniques: Functional Assay, Migration, Coagulation
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: Correlation between miRNA‐EXT1 pairs identified by ENCORI database
Article Snippet: The
Techniques:
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: Kaplan–Meier plots for miRNAs negatively correlated with EXT1 expression in LUSC patients (Kaplan–Meier plotter). LUSC patients with low expression of miRNAs had a poor prognosis. (EXT, Exostosin; LUSC, lung squamous cell carcinoma; miRNA, microRNA)
Article Snippet: The
Techniques: Expressing
Journal: Cancer Medicine
Article Title: Exostosin1 as a novel prognostic and predictive biomarker for squamous cell lung carcinoma: A study based on bioinformatics analysis
doi: 10.1002/cam4.3643
Figure Lengend Snippet: Expression of miRNAs predicted to regulate EXT1 and miRNA‐ EXT1 regulation network (A–C) The expression levels of candidate miRNAs was down‐regulated in tumor tissues (ENCORI). (D) miRNA‐ EXT1 regulation network (Cytoscape). The expression of miRNAs (indicated in green) is down‐regulated and the expression of EXT1 mRNA (indicated in red) is up‐regulated in LUSC. (ENCORI, Encyclopedia of RNA Interactomes; EXT, Exostosin; LUSC, lung squamous cell carcinoma; miRNA, microRNA)
Article Snippet: The
Techniques: Expressing